Back to Journals » Infection and Drug Resistance » Volume 18
Corynebacterium striatum is Not Just a Contaminant: Experience with Antibiotic Treatment of Spondylodiscitis in an Immunocompetent Adult
Authors Huang SM, Wang S, Pan SF, Zhang YY, Wang JL
Received 23 December 2024
Accepted for publication 16 July 2025
Published 4 August 2025 Volume 2025:18 Pages 3867—3873
DOI https://doi.org/10.2147/IDR.S513649
Checked for plagiarism Yes
Review by Single anonymous peer review
Peer reviewer comments 2
Editor who approved publication: Dr Oliver Planz
Shi-Mei Huang,1,* Shuang Wang,2,3,* Su-Fei Pan,1 Yuan-Yuan Zhang,1 Ji-Liang Wang2,3
1Department of Clinical Laboratory, Shengli Oilfield Central Hospital, Dongying, Shandong, People’s Republic of China; 2Department of Central Laboratory, Shengli Oilfield Central Hospital, Dongying, Shandong, People’s Republic of China; 3Dongying Key Laboratory of Cell Biology, Dongying, Shandong, People’s Republic of China
*These authors contributed equally to this work
Correspondence: Ji-Liang Wang, Department of Central Laboratory, Shengli Oilfield Central Hospital, No. 31 Jinan Road, Dongying, Shandong, 257034, People’s Republic of China, Tel +86-0546-8779266, Email [email protected]
Background: Corynebacterium striatum is a commensal skin agent rarely described as a cause of infective spondylodiscitis. In this study, we report the first case of an infected patient who was successfully treated with conservative measures.
Case Presentation: A 54-year-old immunocompetent patient presented with progressive low back pain that had persisted for 1 month. Magnetic resonance imaging revealed abnormal signals in the L4–L5 vertebrae, indicating lumbar spine infection. Laboratory investigations revealed elevation of the serum C-reactive protein level and erythrocyte sedimentation rate. Blood and disc biopsy tissue cultures produced cream-colored round raised colonies on blood agar plates, which were identified as C. striatum using matrix-assisted laser desorption ionization time-of-flight mass spectrometry and 16S rRNA sequencing. Based on the antibiotic sensitivity test results, vancomycin and linezolid were sequentially administered to treat C. striatum infection; however, this strategy proved ineffective after 12 days. Despite delayed symptomatic treatment, the patient was successfully treated with a 2-week course of linezolid based on the use of amikacin to control other pathogens.
Conclusion: C. striatum can cause discitis in patients without any medical or surgical complications. The infection was successfully treated with anti-infective agents, providing empirical information on spinal infections.
Keywords: C. striatum, spondylodiscitis, conservative treatment, spinal infections
Introduction
Corynebacterium striatum is an aerobic and facultative anaerobic gram-positive bacterium that is part of normal human skin and mucous membranes.1 In many countries, C. striatum is considered a potential MDR pathogen usually associated with surgery or bloodstream infections, causing bacteremia, artificial knee infections, and acute or chronic spondylitis.2–5 While usually associated with postoperative infections, C. striatum may also emerge secondary to hematogenous spread.6 Notably, spontaneous spondylodiscitis caused by C. striatum remains exceptionally rare, with only one documented case in medical literature.7 This infectious process involves inflammatory destruction of intervertebral discs, adjacent vertebrae, and paraspinal structures, potentially leading to acute sepsis, neurological compromise from epidural abscess formation, vertebral collapse, and multiorgan dysfunction.4,8 Although post-traumatic and postoperative cases have increased in frequency, approximately 20% of spondylodiscitis cases occur spontaneously without identifiable predisposing factors.9,10 The diagnostic challenge posed by nonspecific clinical presentation frequently results in delayed treatment, contributing to mortality rates approaching 27%.8 Therapeutic management of C. striatum infections presents significant clinical challenges due to limited evidence guiding antimicrobial selection and dosing strategies.11 Current guidelines emphasize the importance of integrating pharmacokinetic/pharmacodynamic (PK/PD) principles with in vitro susceptibility data to ensure adequate tissue penetration at infection sites.12 Glycopeptides (vancomycin, teicoplanin) and oxazolidinones (linezolid) demonstrate reliable in vitro activity and clinical efficacy, often requiring combination therapy with aminoglycosides like gentamicin for synergistic effects.13,14 Amikacin, a broad-spectrum aminoglycoside primarily indicated for Gram-negative infections, shows particular utility in managing severe systemic infections when combined with anti-Gram-positive agents.15 We present a novel case of spontaneous C. striatum spondylodiscitis in an immunocompetent patient without identifiable risk factors, successfully managed through combination therapy with linezolid and amikacin.
Case Description
A 54-year-old man presented to our department with a month-long history of low back pain that had intensified over the past 20 days and had radiated to the lower hip in the last 2 days. He had no history of trauma, fever, weight loss, surgery, or cancer. The only positive findings on physical examination were pain in flexion and extension of the lumbar spine, tenderness and percussion of the spinous process at L4–L5, and radiation to the left buttock, including hypoesthesia of the skin of the left buttock and the lateral thigh. Laboratory tests revealed a serum C-reactive protein (CRP) concentration of 16.47 mg/L, erythrocyte sedimentation rate (ESR) of 35 mm/h, white blood cell count of 14.6 × 109/L, blood urea nitrogen (BUN) level of 6.90 mmol/L, and serum creatinine (CRE) level of 75 µmol/L. Magnetic resonance imaging (MRI) indicated a narrow left lateral recess at L5–S1 and changes in bone marrow signals at L4–L5 (Figure 1A).
On the third day of hospitalization, the patient underwent an L4/5 disc biopsy. The excised tissue was sent for pathological and microbiological analyses. Immediate postoperative cefazolin sodium (2.0 g, every 8 h) was administered for usual spondylodiscitis. By day 6, C. striatum was detected in the bacterial cultures of blood samples. Two days of incubation led to the growth of tiny, non-hemolytic, milky white colonies on Columbia blood agar plates from four blood sample cultures (Figure 1B). C. striatum was identified in bacterial cultures of disc biopsy tissues by day 7. After 2 days of incubation, small, non-hemolytic, milky-white colonies were observed on Columbia blood agar plates (Figure 1C). Gram staining of the tissue smear identified C. striatum (Figure 1D).
The identification of the two colonies from blood and tissues biopsies as C. striatum was achieved through matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) and confirmed by 16S rRNA sequencing (primers: 27F, TTGGAGAGTTTGATCCTGGCTC; 1492R, TTGGAGAGTTTGATCCTGGCTC) and phylogenetic tree analysis (Figure 2). The GenBank accession numbers are OR653924 (isolated from tissue biopsies samples) and OR653923 (isolated from blood samples). Thus, vancomycin (1.0 g, every 12 h) was added to the anti-infective regimen.
|
Figure 2 Phylogenetic analyses of C. striatum isolated from tissues (230419114) and blood samples (230417139). |
After 12 days of vancomycin treatment, the CRP level and ESR remained higher than normal, indicating a lack of efficacy. Therefore, the patient received linezolid (0.6 g, every 12 h instead of vancomycin for 8 days. Despite this management, the CRP level and ESR were not decreased, but BUN (7.73 mmol/L) and CRE levels (88.4 µmol/L) were within their normal ranges. An antibiotic sensitivity test (AST) was performed using a commercial kit (broth dilution method, Zhongaisheng, Hebei, China), and the results revealed that the strains isolated from blood and tissue cultures were sensitive to gentamicin, cefepime, cefotaxime, meropenem, ciprofloxacin, tetracycline, doxycycline, daptomycin, rifampicin, vancomycin, and linezolid but resistant to erythromycin and clindamycin (Table 1).
|
Table 1 Antimicrobial Susceptibility Profiles of C. striatum |
Because of uncontrolled infection and AST results, other pathogens were suspected. Therefore, amikacin (0.6 g/day) was added to the anti-infective regimen. Treatment with linezolid (0.6 g, every 12 h) plus amikacin (0.6 g/day) was initiated instead of linezolid alone on the 27th day of hospitalization. Hematological data and CRP levels returned to normal by day 41, indicating the infection was controlled. The patient was discharged with a 2-week oral linezolid regimen. At the last follow-up after 68 days (June 24, 2023), MRI revealed no clinical recurrence (Figure 1E). Details on diagnosis and treatment are presented in Figure 3.
|
Figure 3 Timeline of the patient’s diagnosis and treatment. Abbreviations: VAN, vancomycin; LNZ, linezolid; AMK, amikacin; CFZ, cefazolin. |
Discussion and Conclusions
Spontaneous spondylitis caused by C. striatum is rarely reported, and it usually observed in immunocompromised individuals, especially those with diabetes, immunosuppression, and end-stage renal failure, and in older patients.7 It is widely agreed that the occurrence of spinal infections, such as idiopathic discitis, is increasing.16 Based on the current case, it is further believed that colonizers that were initially considered harmless contaminants can cause human infection. More crucially, this case emphasizes the necessity to view C. striatum as a pathogen in certain medical contexts.
The virulence of C. striatum species should not be underestimated, particularly in patients with normal immune function. The patient in this case had a C. striatum infection that resulted in lower back pain and higher CRP and ESR levels. However, the patient had no fever that is consistent with the literature description: fever is less common in cases of clinical suspicion of discitis, accounting for 48% to 63% of cases.17 Thus, identification of the pathogen should be considered in patients with normal immune function who develop unexplained spinal pain, particularly in those with elevated laboratory inflammation markers. Not only in cases of fever, but also in clinically bland cases and in patients without fever.
Studies revealed that 16S rRNA sequencing and MALDI-TOF MS are highly reliable for identifying pathogens.18 In our case, the colonies were identified as C. striatum, with scores of 2.300 (blood) and 2.245 (tissue) after 2 days of incubation on blood agar. Similarly, 16S rRNA sequencing confirmed species-level identity (100% homology) between blood and tissue samples, with identical sequences observed for both specimen types. For swift detection of this pathogen, we advise employing MALDI-TOF MS once colonies are isolated. Due to its convenience, accuracy, and low cost of reagents and consumables, it is also being cost-effectively applied in various areas of clinical microbiology.19
As Streifel et al recommended, antibiotic therapy can be considered a reasonable treatment option.20 Vancomycin and linezolid are among the anti-infective agents that have been successfully employed to treat C. striatum infections.21 The C. striatum isolates in our study were susceptible to gentamicin, vancomycin, and linezolid but intrinsically resistant to some antibiotics, such as erythromycin, clindamycin, and co-trimoxazole. The antibiotic susceptibility profile is mostly akin to that reported by Alibi et al.22 Given that each isolate’s antibiotic susceptibility profile varied in an unpredictable manner, an appropriate AST should be conducted to determine which antimicrobial agents, including macrolides, lincosamides, fluoroquinolones, beta-lactams, and rifampicin, are effective for treating C. striatum infections before beginning antibiotic therapy. For our patient, despite microbiologically guided therapy and administration of vancomycin-linezolid monotherapy-a regimen associated with clinical cure-elevated inflammatory markers suggested suboptimal infection control. This discrepancy highlights multifactorial challenges in managing spinal infections, including comorbidities or immunometabolic variations, pathogen virulence dynamics, and antibiotic pharmacokinetic limitations. Notably, experimental models reveal diminishing bone penetration of vancomycin during progressive osteomyelitis, potentially explaining attenuated therapeutic responses in deep-seated infections.23 Other than that the rising prevalence of MDR pathogens further complicates treatment strategies. Current data indicate high resistance rates among Gram-negative organisms to first-line agents like cefazolin and ciprofloxacin,24 necessitating broad-spectrum coverage in polymicrobial or high-risk scenarios. Amikacin was added to the anti-infective regimen to control other pathogens. But,Combination therapies remain contentious, with heterogeneous evidence supporting β-lactam/glycopeptide synergism.25
Overall, this case is interesting because it is extremely rare for a severe non-staphylococcal organism to invade the spine of a healthy individual. C. striatum can cause severe invasive infections of various tissues, and these infections can also occur in immunocompetent hosts. According to the existing literature and susceptibility trends, linezolid is the most suitable first-line treatment.
Abbreviations
MDR, multidrug-resistant pathogen; CRP, C-reactive protein; ESR, erythrocyte sedimentation; AST, An antibiotic sensitivity test; MALDI-TOF MS, matrix-assisted laser desorption ionization time-of-flight mass spectrometry; PK, pharmacokinetic; PD, pharmacodynamic; BUN, blood urea nitrogen; CRE, serum creatinine; MRI, Magnetic resonance imaging.
Data Sharing Statement
The original contributions of this study are included in the article. Further inquiries can be directed to the corresponding author.
Ethics Approval
This study, involving a human participant, was reviewed and approved by the Ethics Committee of Shengli Oilfield Central Hospital (NO. YXLL 202515301). Written informed consent for experiment and publication was obtained from the patient. The consent form is available for review by the editor if needed.
Consent for Publication
No potentially identifiable human images or data are presented in this study.
Acknowledgments
We thank Joe Barber Jr., PhD, from Liwen Bianji (Edanz) (www.liwenbianji.cn) for editing the English text of a draft of this manuscript.
Author Contributions
All authors made a significant contribution to the work reported, whether that is in the conception, study design, execution, acquisition of data, analysis and interpretation, or in all these areas; took part in drafting, revising or critically reviewing the article; gave final approval of the version to be published; have agreed on the journal to which the article has been submitted; and agree to be accountable for all aspects of the work.
Funding
There is no funding to report.
Disclosure
The authors report no other conflicts of interest in this work.
References
1. Weiss K, Labbé AC, Laverdière M. Corynebacterium striatum meningitis: case report and review of an increasingly important Corynebacterium species. Clin Infect Dis. 1996;23(6):1246–1248. doi:10.1093/clinids/23.6.1246
2. Yamamuro R, Hosokawa N, Otsuka Y. Clinical Characteristics of Corynebacterium Bacteremia Caused by Different Species, Japan, 2014–2020. Emerg Infect Dis. 2021;27:2981–2987. doi:10.3201/eid2712.210473 .
3. Shariff M, Aditi A, Beri K. Corynebacterium striatum: an emerging respiratory pathogen. J Infect Developing Countries. 2018;12(07):581–586. doi:10.3855/jidc.10406
4. Hollnagel K, Willen J, Ellis M, et al. Chronic Corynebacterium striatum Septic Arthritis in a Patient Referred for Total Knee Arthroplasty. Case Rep Orthoped. 2020;2020:1392182. doi:10.1155/2020/1392182
5. Ogasawara M, Matsuhisa T, Kondo T, et al. Pyogenic spondylitis with acute course caused by Corynebacterium simulans. J Infect Chemother. 2020;26(3):294–297. doi:10.1016/j.jiac.2019.10.012
6. Noussair L, Salomon E, El Sayed F, et al. Monomicrobial bone and joint infection due to Corynebacterium striatum: literature review and amoxicillin-rifampin combination as treatment perspective. EurJ Clin Microbiol Infect Dis. 2019;38(7):1269–1278. doi:10.1007/s10096-019-03542-x
7. Sharifi G, Bakhtevari MH, Nabizadeh N, et al. Spontaneous Corynebacterium spondylodiskitis in an immunocompetent patient: a case report and literature review. J Spinal Cord Med. 2016;39(6):730–733. doi:10.1179/2045772315Y.0000000040
8. Heuer A, Strahl A, Viezens L, et al. The Hamburg Spondylodiscitis Assessment Score (HSAS) for Immediate Evaluation of Mortality Risk on Hospital Admission. J Clin Med. 2022;11(3):660. doi:10.3390/jcm11030660
9. Gouliouris T, Aliyu SH, Brown NM. Spondylodiscitis: update on diagnosis and management. J Antimicrob Chemother. 2010;65(Supplement 3):iii11–24. doi:10.1093/jac/dkq303
10. Lang S, Walter N, Schindler M, et al. The Epidemiology of Spondylodiscitis in Germany: a Descriptive Report of Incidence Rates, Pathogens, In-Hospital Mortality, and Hospital Stays between 2010 and 2020. J Clin Med. 2023;12(10):3373. doi:10.3390/jcm12103373
11. Lacasse M, Derolez S, Bonnet E, et al. Review group. 2022 SPILF - Clinical Practice guidelines for the diagnosis and treatment of disco-vertebral infection in adults. Infect Dis Now. 2023;53(3):104647. doi:10.1016/j.idnow.2023.01.007
12. Rodríguez-Gascón A, Solinís MÁ, Isla A. The Role of PK/PD Analysis in the Development and Evaluation of Antimicrobials. Pharmaceutics. 2021;13(6):833. doi:10.3390/pharmaceutics13060833
13. Orosz L, Sóki J, Kókai D et al. Burián K. Corynebacterium striatum-Got Worse by a Pandemic? Pathogens. 2022;11(6):685. doi:10.3390/pathogens11060685
14. Wen S, Zhang T, Yu X, et al. Bone penetration of linezolid in osteoarticular tuberculosis patients of China. Int J Infect Dis. 2021;103:364–369. doi:10.1016/j.ijid.2020.11.203
15. Maxwell A, Ghate V, Aranjani J et al. Breaking the barriers for the delivery of amikacin: challenges, strategies, and opportunities. Life Sci. 2021;284:119883. doi:10.1016/j.lfs.2021.119883
16. Sur A, Tsang K, Brown M et al. Management of adult spontaneous spondylodiscitis and its rising incidence. Ann Royal Coll Surg Engl. 2015;97(6):451–455. doi:10.1308/rcsann.2015.0009
17. Gregori F, Grasso G, Iaiani G, et al. Treatment algorithm for spontaneous spinal infections: a review of the literature. J Craniovertebr Junction Spine. 2019;10(1):3–9. doi:10.4103/jcvjs.JCVJS_115_18
18. Yeo K, Connell J, Bouras G, et al. A comparison between full-length 16S rRNA Oxford nanopore sequencing and Illumina V3-V4 16S rRNA sequencing in head and neck cancer tissues. Arch Microbiol. 2024;206(6):248. doi:10.1007/s00203-024-03985-7
19. Tsuchida S, Umemura H, Nakayama T. Current Status of Matrix-Assisted Laser Desorption/Ionization-Time-of-Flight Mass Spectrometry (MALDI-TOF MS) in Clinical Diagnostic Microbiology. Molecules. 2020;25(20):4775. doi:10.3390/molecules25204775
20. Streifel AC, Varley CD, Ham Y, et al. The challenge of antibiotic selection in prosthetic joint infections due to Corynebacterium striatum: a case report. BMC Infect Dis. 2022;22(1):290. doi:10.1186/s12879-022-07270-0
21. Kurimoto T, Cho Y, Matsuoka T. Multidrug-Resistant Corynebacterium striatum Developed During Treatment of Ommaya Reservoir Infection. Int Med Case Rep J. 2022;Volume 15:231–234. doi:10.2147/IMCRJ.S361505
22. Alibi S, Ferjani A, Gaillot O, et al. Identification of clinically relevant Corynebacterium strains by Api Coryne, MALDI-TOF-mass spectrometry and molecular approaches. Pathologie. 2015;63(4–5):153–157. doi:10.1016/j.patbio.2015.07.007
23. Slater J, Stilling M, Hanberg P, et al. Concentrations of Co-Administered Meropenem and Vancomycin in Spinal Tissues Relevant for the Treatment of Pyogenic Spondylodiscitis-An Experimental Microdialysis Study. Antibiotics. 2023;12(5):907. doi:10.3390/antibiotics12050907
24. Bue M, Hanberg P, Koch J, et al. Single-dose bone pharmacokinetics of vancomycin in a porcine implant-associated osteomyelitis model. J Orthop Res. 2018;36(4):1093–1098. doi:10.1002/jor.23776
25. Lang S, Walter N, Neumann C, et al. Aktuelle Praxis der empirischen Antibiotikatherapie bei Spondylodiszitis [Current practice of empiric antibiotic treatment for spondylodiscitis]. Orthopadie. 2022;51(7):540–546. doi:10.1007/s00132-022-04240-x
© 2025 The Author(s). This work is published and licensed by Dove Medical Press Limited. The
full terms of this license are available at https://www.dovepress.com/terms
and incorporate the Creative Commons Attribution
- Non Commercial (unported, 4.0) License.
By accessing the work you hereby accept the Terms. Non-commercial uses of the work are permitted
without any further permission from Dove Medical Press Limited, provided the work is properly
attributed. For permission for commercial use of this work, please see paragraphs 4.2 and 5 of our Terms.
