Back to Journals » Infection and Drug Resistance » Volume 18
Mapping Knock-Down Resistance Mutations in Head-Louse Populations in Jazan, Saudi Arabia
Authors Zelai NT
Received 11 May 2025
Accepted for publication 14 August 2025
Published 20 August 2025 Volume 2025:18 Pages 4201—4206
DOI https://doi.org/10.2147/IDR.S539626
Checked for plagiarism Yes
Review by Single anonymous peer review
Peer reviewer comments 2
Editor who approved publication: Dr Arif Siddiqui
Noha Talal Zelai
Department of Biological Sciences, Faculty of Science, King Abdulaziz University, Jeddah, Saudi Arabia
Correspondence: Noha Talal Zelai, Department of Biological Sciences, Faculty of Science, King Abdulaziz University, Aljameah Road, Jeddah, 21551, Saudi Arabia, Tel +966509357153, Email [email protected]
Introduction: Pediculosis capitis remains a persistent public-health concern. Although pyrethroids are still the first-line treatment, their effectiveness is threatened by knock-down resistance (kdr), which arises from point mutations in the voltage-sensitive sodium channel (VSSC). This study aimed to assess the prevalence of kdr mutations in head lice populations across different regions of Jazan, Saudi Arabia.
Methods: In this study, 59 head-louse specimens from multiple regions of Jazan were analyzed by PCR amplification and Sanger sequencing of a 908-bp fragment of the VSSC α-subunit gene.
Results: The T917I mutation showed the highest allele frequency (0.38) and was concentrated in Jazan’s southern and eastern border areas.
Discussion: While overall kdr prevalence in Jazan is low, targeted surveillance is warranted in these regions, where resistance appears to be emerging.
Keywords: Pediculosis capitis, knock-down resistance, voltage-sensitive sodium channel, T917I, Jazan
Introduction
Pediculus humanus capitis is an obligate blood-sucking ectoparasite that infects human scalp.1 The infection may be asymptomatic, or it may be severe, leading to excessive itching and scratching of the skin.2
Previous and recent records indicate a rising increase in the prevalence of Pediculus infestation with time. In 2021, Baghdadi et al reported 87.86% Pediculus infestation in the Eastern Region, Saudi Arabia, amongst 750 participants.3 In a study on 438 participants in Makkah, Western Region, Saudi Arabia, Assaedi et al found a high infestation degree of head lice (64.2%).4 Another study conducted in 2017 in Jeddah, Western Region, Saudi Arabia, showed Pediculus infestation of 31% amongst 337 female secondary school students.5 In 2016, a prevalence of 45.45% was recorded in Albaha, Southern Region, Saudi Arabia, amongst 672 primary schoolgirls.6
However, in earlier studies, head louse infestation was less common. The prevalence of pediculosis was between 5 and 13% amongst study participants in various areas: 5.2% in Al-khobar, Eastern Region, Saudi Arabia;7 9.6% in Abha, Southern Region, Saudi Arabia;8 12% in Jeddah, Western Region, Saudi Arabia,9 and 13.3% in Jazan, Southern Region, Saudi Arabia.10 This increase in Pediculus infestation needs to be taken into consideration in the treatment of head lice, as it is a sign of resistance.
Several studies have shown that the resistance of head lice to insecticide might be related to pyrethroid-associated knockdown mutation (kdr).11,12 This is especially relevant to Jazan due to growing local concerns about treatment resistance. This is due to the fact that pyrethroid is the most commonly used insecticide for combating lice.13 A study in Jeddah showed that the frequency of pyrethroid-resistant alleles was 62.2%, with all alleles being homozygous in T917I.14 Another study in Riyadh showed higher frequency (83%) of homo- and heterozygous resistant alleles in T917I, when compared to 75% homozygous resistant alleles in L920H, in addition to novel double mutations in V966F and F967L with fequencies of 90 and 85%, respectively.15 In view of the high frequency of resistance, more studies are needed to identify the kdr mutations in other regions of Saudi Arabia.
The aim of study was to determine the frequency of resistance-linked mutation associated with pyrethroid treatment in Jazan.
Materials and Methods
The steps of the methodology are shown in the flowchart in Figure 1.
|
Figure 1 Flowchart of the workflow from sample collection to statistical analysis. |
Louse Samples
Fifty-nine samples of adult lice were collected by dry combing from 4 to 6 years old female kindergarten children in different schools in Jazan regions, using a metal comb, in line with relevant guidelines and regulations. The number of samples was determined based on the need to represent different subregions within Jazan, and the availability of samples during surveillance period. This sample size was considered sufficient for initial detection of kdr mutations in Jazan, based on a previous study that used 45 samples to investigate kdr mutations in different regions of Jeddah.14
Each sample was placed in a sterile microcentrifuge tube, transported to the laboratory in an ice box and stored at −20°C for further analysis. All samples were examined under a magnifying lens to separate the larger, well-characterized adult lice from nymphs. Eggs were also excluded from the analysis. This study was conducted in accordance with the ethical principles outlined in the Declaration of Helsinki. The study was approved by the Biomedical Ethics Committee of King Abdulaziz University Faculty of Medicine (approval reference no.: 130-2). Informed consent for this study was obtained from the legal guardians of the participants.
DNA Extraction and Conventional PCR
After excluding nymphs and eggs, the adult louse samples were homogenized, and DNA was extracted using Qiagen DNA Mini Kit (Cat. No. 51304) in accordance with the kit manufacturer’s protocol. The VSSC α-subunit gene PCR was done as described earlier using Trans 2X EasyTaq PCR SuperMix (+Dye) Cat. no. AS111-AJ-11.16 The primers were selected based on a previous study: 5′-ATTTTGCGTTTGGGACTGCTGTT; 3′ (sense) and 5′CCATCTGGGAAGTTCTTTATCCA (antisense).17 The PCR conditions were initial denaturation for 5 min at 94 °C and 35 cycles of denaturation for 45 sec at 94 °C, annealing for 45 sec at 55 °C, extension at 72 °C for 1 min, and final primer extension for 7 min at 72 °C.
The PCR products were loaded on 1.5–2% Agarose gel and visualized using Qiagen DNA ladder (GelPilot 100 bp Plus ladder, Cat. No. 239045).
DNA Sequencing
PCR products were purified using a PCR purification kit (QIAquick PCR Purification Kit, Qiagen) following the manufacturer’s instructions. Purified amplicons were assessed for quality using a nanodrop spectrophotometer before proceeding to sequencing. Sanger sequencing of 908 bp gDNA fragment of the VSSC a-subunit gene was done in order to identify the resistant and susceptible genes in the samples.17 Negative controls were included in each run for quality control. Molecular Evolutionary Genetics Analysis version 11 was used for aligning and visualizing sample sequence, with reference to GenBank ID: AY191156.1.
Statistical Analysis
The percentage of each genotype (RR, RS, and SS) was calculated for each sample. In addition, Hardy–Weinberg expectations with Wright’s inbreeding coefficient were used to calculate the frequencies of expected genotype. Then, chi square test was applied to compare Hardy–Weinberg expectations with the observed counts. Analysis was done using GraphPad Prism version 9 and GenAlEx version 6.5.
Results
Head lice samples were taken from female nursery children (4–6 years) in Northern (n=15), Southern (n=15), Eastern (n=15) and Western (n=14) regions of Jazan in order to study the likelihood of head louse resistance to pyrethrin in this location.
Sanger sequencing was done for all samples, and bioinformatic analysis was applied to determine the presence and heterogenicity of mutations in VSSC gene. The results showed that V966F and F967L were absent in all tested samples, an indication of wild-type alleles.
The other three loci: T917I, L920H and M815I showed the absence of heterozygotes (RS=0). High Fis indicated perfect heterozygotes deficit (Table 1).
|
Table 1 Genotype Distribution of Kdr Mutations in Jazan (n=59) |
Sampling was done from the north, south, east and west of Jazan. The distribution of T917I, L920H and M815I mutations is illustrated in Table 2:
|
Table 2 Allele Variability in Different Locations Inside Jazan (n=15 in the Northern, Southern and Eastern Regions, While N = 14 in the Western Region) |
The results showed that northern Jazan had wild type VSSC gene (χ2 = 0), as it lacked mutations. However, the southern area of Jazan showed high frequencies of the three mutations T917I, L920H and M815I (0.7, 0.6 and 0.6, respectively) and (χ2 = 1, 1.01 and1.0, respectively), with a positive Fis which indicated a heterozygote deficit. The eastern area of Jazan showed high frequency (0.7) of T917I (χ2 = 1) and low frequency (0.3) of L920H (χ2 = 1). In the western area of Jazan, only one mutation was detected in T917I at low frequency of 0.2 (χ2 = 1). Thus, the population deviated significantly from HW equilibrium.
Discussion
In this study, pyrethroid-resistant mutation was determined in Jazan, Saudi Arabia. Three point mutations were detected in T917I, L920H, and M815I.
The most important mutation was T917I which was associated with threonine-to-isoleucine substitution in 917, and it was due to the substitution of cytosine with thymine. The L920H mutation was correlated with the exchange of leucine with histidine in 920, corresponding to the substitution of CTT with CAT. The M815I mutation was associated with substitution of methionine with isoleucine in 815 due to replacement of ATG with ATT. In 966, V966F mutation was related to substitution of GTT with TTT leading to amino acid change from valine to phenylalanine. In addition, a mutation led to the replacement of phenylalanine with leucine in 967 (TTT to TTA).
These mutations were found in low frequencies. The highest frequencies of these mutations were observed in the southern and eastern regions of Jazan. This may be attributed to the emergence of novel local mutations that cause this heterogenicity.18
The L920H is a point mutation which was detected previously in Riyadh, Saudi Arabia.15 Similarly, this mutation was detected in Jazan at a lower total frequency of 0.230, when compared to a frequency of 0.73 in Riyadh. However, the novel double mutations identified in Riyadh (V966F and F967L) were not detected in this study.
Mutation in M815I is one of the three mutations (T929I, L932F and M815I) that may form a haplotype, and it is commonly found together with the other mutations as an indication of pyrethroid resistance in the tested samples.19 This mutation was detected at a low frequency of 0.150, mainly in the Southern region. In previous studies, M815I mutation was seen at higher frequencies of 0.98 in the United States20 and 1 in Turkey.21 This disparity may be explained by the variation in the frequency and protocol of pyrethroid use. The uncontrolled usage of pyrethroid-based treatment could be the reason for the elevated incidence in the United States and Turkey.22 In addition, the boarder research area and greater social and behavioral variation in head lice control procedures in these countries may also affect the frequency of this mutation. In the other hand, the lower frequency of mutation in Jazan could be attributed to a more restricted use, a decreased reliance on chemical pediculicides, or an earlier phase of resistant allele spread. Furthermore, the distribution of resistant mutations may also be influenced by variations in public health practices and population movement, in addition to environmental factors.
The T917I mutation is a strong indication of kdr mutation, even if found alone. Previous studies in Saudi Arabia revealed a higher frequency of T917I than that seen in the present study (0.38). In Riyadh and Jeddah, Saudi Arabia, the frequencies of this mutation were 0.83 and 0.62, respectively. This may be attributed to the smaller size and lower heterogenicity of populations in Jazan, when compared to those in Jeddah and Riyadh, Saudi Arabia.
Conclusion
Jazan has a low overall frequency of kdr mutations than other areas in Saudi Arabia. The most frequent mutations were found in the southern regions, suggesting a development of regional resistance. These findings highlight the need to control the spread of pyrethroid resistance through continuous surveillance and the development of novel strategies using up-to-date technology.
Acknowledgments
The author gratefully acknowledges the WAQF and the Deanship of Scientific Research (DSR) for their invaluable technical and financial assistance.
Disclosure
The author reports no conflicts of interest in this work.
References
1. Nash B. Treating head lice. BMJ. 2003;326:1256–1258. doi:10.1136/bmj.326.7401.1256
2. Mumcuoglu KY, Klaus S, Kafka D, et al. Clinical observations related to head lice infestation. J Am Acad Dermatol. 1991;25:248–251. doi:10.1016/0190-9622(91)70190-d
3. Baghdadi HB, Omer EOM, Metwally DM, et al. Prevalence of head lice (Pediculus humanus capitis) infestation among school workers in the Eastern Region, Saudi Arabia. Saudi J Biol Sci. 2021;28:5662–5666. doi:10.1016/j.sjbs.2021.06.013
4. Assaedi LM, Alharbi AH, Aldor SM, et al. The prevalence of pediculosis capitis in Makkah City, Saudi Arabia. Our Dermatol Online. 2018;9:114–117. doi:10.7241/ourd.20182.2
5. Al Abdullah N, Kaki R. Lindane shampoo for head-lice treatment among female secondary-school students in Jeddah, Saudi Arabia: an interventional study. J Infect Dis Prev Med. 2017;5:1–4. doi:10.4172/2329-8731.1000173
6. Gharsan FN, Abdel-Hamed NF, Mohammed Elhassan SAA, et al. Prevalence of infection with head lice Pediculus humanus capitis among elementary-school girls in Albaha Region, Saudi Arabia. Int J Res Dermatol. 2016;2:12–17. doi:10.18203/issn.2455-4529.IntJResDermatol20161426
7. Al-Saeed WY, Al-Dawood KM, Bukhari IA, et al. Prevalence and pattern of skin disorders among female schoolchildren in Eastern Saudi Arabia. Saudi Med J. 2006;27:227–234.
8. Bahamdan K, Mahfouz AA, Tallab T, et al. Skin diseases among adolescent boys in Abha, Saudi Arabia. Int J Dermatol. 1996;35:405–407. doi:10.1111/j.1365-4362.1996.tb03020.x
9. Boyle P. Pilot study of the prevalence of head-lice infestation in a population of Saudi Arabian children. Fam Pract. 1987;4:138–142. doi:10.1093/fampra/4.2.138
10. Bosely AH, El-Alfy HN. Head-lice infestations (Anoplura: pediculidae) in Saudi and non-Saudi school-aged children. J Egypt Soc Parasitol. 2011;41:131–140.
11. Burgess I. Head lice: resistance and treatment options. Pharm J. 2016;297. doi:10.1211/PJ.2016.20201639
12. Burkhart CG, Burkhart CN. Clinical evidence of lice resistance to over-the-counter products. J Cutan Med Surg. 2000;4:199–201. doi:10.1177/120347540000400405
13. Durand R, Bouvresse S, Berdjane Z, et al. Insecticide resistance in head lice: clinical, parasitological, and genetic aspects. Clin Microbiol Infect. 2012;18:338–344. doi:10.1111/j.1469-0691.2012.03806.x
14. Alsaady IM, Altwaim S, Gattan HS, et al. Prevalence of permethrin-resistant kdr mutation in head lice (Pediculus humanus capitis) from elementary-school students in Jeddah, Saudi Arabia. PeerJ. 2023;11:e16273. doi:10.7717/peerj.16273
15. Alghashmari IH, Zelai NT. Knockdown-resistant mutations in head lice (Pediculus humanus capitis) collected from schoolchildren in Riyadh, Saudi Arabia. Sci Rep. 2025;15:2412. doi:10.1038/s41598-025-86574-y
16. Durand R, Pagès N, Bossé J, et al. Detection of pyrethroid-resistance genes in head lice in schoolchildren from Bobigny, France. J Med Entomol. 2007;44:796–798. doi:10.1603/0022-2585(2007)44[796:doprgi]2.0.co;2
17. Kwon DH, Yoon KS, Strycharz JP, et al. Determination of permethrin-resistance allele frequency in human head-louse populations by quantitative sequencing. J Med Entomol. 2008;45:912–920. doi:10.1093/jmedent/45.5.912
18. Jazan Municipality. About Jazan [Internet]. 2025 [cited May 10, 2025]. Available from: https://www.jazan.sa/ar/Pages/AboutJazan.aspx.
19. Kristensen M. Identification of sodium-channel mutations in human head louse (Anoplura: pediculidae) from Denmark. J Med Entomol. 2005;42:826–829. doi:10.1603/0022-2585(2005)042[0826:IOSCMI]2.0.CO;2
20. Gellatly KJ, Krim S, Palenchar DJ, et al. Expansion of the knockdown-resistance frequency map for human head lice (Phthiraptera: pediculidae) in the United States using quantitative sequencing. J Med Entomol. 2016;53:653–659. doi:10.1093/jme/tjw023
21. Karakuş M, Atıcı T, Karabela ŞN, et al. Detection of permethrin resistance and phylogenetic clustering of Turkish head lice (Pediculus humanus capitis) populations. Acta Trop. 2020;204:105362. doi:10.1016/j.actatropica.2020.105362
22. Firooziyan S, Sadaghianifar A, Taghilou B, et al. Identification of novel voltage-gated sodium-channel mutations in human head and body lice (Phthiraptera: pediculidae). J Med Entomol. 2017;54:1337–1343. doi:10.1093/jme/tjx107
© 2025 The Author(s). This work is published and licensed by Dove Medical Press Limited. The
full terms of this license are available at https://www.dovepress.com/terms
and incorporate the Creative Commons Attribution
- Non Commercial (unported, 4.0) License.
By accessing the work you hereby accept the Terms. Non-commercial uses of the work are permitted
without any further permission from Dove Medical Press Limited, provided the work is properly
attributed. For permission for commercial use of this work, please see paragraphs 4.2 and 5 of our Terms.
