SEMA4F Regulates the Malignant Phenotype of Hepatocellular Carcinoma Cells Through the PI3K-Akt Pathway

Introduction

Hepatocellular carcinoma (HCC) originates from hepatocytes and accounts for approximately 75–85% of primary liver cancers.¹ As one of the most aggressive malignant tumors worldwide, it is characterized by high morbidity and mortality rates. China bears an especially heavy disease burden: currently, liver cancer ranks fourth in terms of cancer incidence in the country and is also the second leading cause of cancer-related deaths.² Despite significant advances in surgical resection, liver transplantation, local ablation, and targeted therapy in recent years, the overall prognosis of HCC patients remains poor, with a five-year survival rate of less than 20%. This grim clinical situation is mainly attributed to the high heterogeneity of HCC, difficulties in early diagnosis, high propensity for metastasis and recurrence, as well as widespread resistance to traditional chemotherapeutic drugs. Therefore, in-depth investigation into the molecular mechanisms underlying HCC occurrence and development, along with the identification of novel therapeutic targets and biomarkers, has become an urgent priority in the field of liver cancer research.

In the complex molecular pathogenesis of HCC, the aberrant activation of key signal transduction pathways (most notably Wnt/β-catenin, MAPK, p53, TGF-βand AKT/c-Myc) alongside remodeling of the tumor microenvironment, plays pivotal roles.^3,4 Among these, the Semaphorin family, a class of important cell-surface and secreted signaling molecules, has been shown in recent years to be involved not only in neuronal development and axon guidance but also in abnormal expression in various solid tumors, where it regulates tumor progression by modulating processes such as cell migration, invasion, angiogenesis, and immune microenvironment. Semaphorin 4F (SEMA4F), a member of the class IV Semaphorin subfamily, was initially identified as a transmembrane protein with functions in axon guidance. Through its SEMA domain, SEMA4F binds to extracellular ligands, thereby triggering signal transduction and regulating biological processes including cell proliferation, differentiation, apoptosis, and immune cell function.^5,6 Recent studies have demonstrated that SEMA4F is involved in tumor metastasis and tumor microenvironment remodeling: for instance, high SEMA4F expression is associated with poor prognosis in gastric cancer patients;⁷ in glioma, this protein can promote tumor invasion through “neuron-cancer cell” signal crosstalk.⁸

To date, systematic research on the specific role of SEMA4F in HCC is still lacking. Limited preliminary data indicate that SEMA4F, as an immune-related gene (IRG) associated with the survival of HCC patients, may exhibit abnormal expression in HCC tissues. However, its clinical significance, functional role, and precise molecular mechanisms remain unclear. Given the context-dependent dual pro-tumor or anti-tumor functions of SEMA4F observed in other cancers, as well as the unique pathophysiological environment of HCC, systematic exploration of the functional mode of SEMA4F in HCC is of great significance.This study aims to systematically elucidate the biological functions and molecular mechanisms of the SEMA4F gene in the occurrence and development of HCC.

Materials and Methods

Bioinformatic Analysis

A pan-cancer analysis was conducted using the GEPIA2 database (http://gepia2.canc-pku.cn/), which revealed that the SEMA4F gene was significantly upregulated in HCC tissues compared to adjacent normal liver tissues (P < 0.05). This finding was further validated using The Cancer Genome Atlas (TCGA)-LIHC dataset. The mRNA expression profiles, clinical data and survival data of SEMA4F in LIHC were downloaded from TCGA database (https://portal.gdc.cancer.gov/), encompassing 369 HCC samples and 50 adjacent non-tumor samples.

The cDNA libraries constructed from pooled RNA of HUH-7 SEMA4F-OE cells and wild-type (WT) cells were sequenced using the Illumina Novaseq™ X Plus platform. Differential gene expression analysis was performed between the two groups using the DESeq2 software (e edgeR was applied for comparisons between two samples). Genes with a false discovery rate (FDR) < 0.05 and an absolute fold change ≥ 2 were defined as differentially expressed genes (DEGs). Subsequently, Gene Set Enrichment Analysis (GSEA, v4.1.0) and MSigDB were employed for GO analysis, and KEGG and Reactome pathway enrichment analyses on the DEGs.

Cell Lines and Cell Culture

The human HCC cell lines HEPG2 and HUH-7 were obtained from the Cellverse Bioscience Technology Co., Ltd (Shanghai, China), PLC and HEP3B were obtained from the Stem Cell Bank, Chinese Academy of Sciences (Shanghai, China). HEPG2, HUH-7, and PLC cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), HEP3B cells were maintained in Minimum Essential Medium (MEM) containing 10% FBS. All cell lines were incubated at 37°C in a humidified atmosphere with 5% CO₂. Cells were routinely passaged upon reaching 80–90% confluence. For long-term storage, cells were cryopreserved in their logarithmic growth phase. All cell culture procedures were performed under sterile conditions within a biosafety cabinet.

Construction of SEMA4F Overexpression and Knockdown Cell Lines

The SEMA4F overexpression lentivirus (vector name: LV5-EF1a-GFP+PURO) (GenePharma, Shanghai, China) was transfected into HUH-7 cells according to the manufacturer’s instructions. At 72 hours post-transfection, stable cell clones were selected using 1 μg/mL puromycin, and transfection efficiency was verified by qRT-PCR.

In the loss-of-function experiment, a PLC/SEMA4F-siRNA cell model was successfully established by transfecting PLC cells with SEMA4F-targeting siRNA (siRNA-468: Forward 5′- GGAAGAAAGGCAAGAAAGATT −3′, Reverse 5′- UCUUUCUUGCCUUUCUUCCTT −3′). The siRNA and transfection reagent Lipofectamine RNAiMAX (Thermo Fisher Scientific, USA) were diluted separately in serum-free medium according to the manufacturer’s protocol, incubated at room temperature for 5–10 minutes, mixed, and then incubated for another 15–20 minutes to form complexes. The complexes were added dropwise to the culture medium of PLC cells and gently mixed. Cells were collected 48–72 hours post-transfection, and SEMA4F mRNA expression was detected by RT-qPCR.

Colony Formation Assay

To assess the colony-forming ability of cells, transfected cells were seeded into 6-well plates at a density of 1000 cells per well, with three replicates per group, and incubated at 37°C for 9 days to allow colony formation. Colonies were washed twice with phosphate-buffered saline (PBS), and 1 mL of 4% paraformaldehyde solution was added to each well to fix the cells for 30–60 minutes. After washing, colonies were stained with crystal violet (Beyotime Biotechnology, China). Colonies containing ≥ 50 cells were counted under a microscope.

EDU (5-Ethynyl-2′-Deoxyuridine) Proliferation Assay

Cells were seeded at an appropriate density and incubated overnight under standard culture conditions (37°C, 5% CO₂). The original medium was aspirated and replaced with medium containing EDU, followed by incubation for 2–24 hours. After washing, cells were fixed with 4% paraformaldehyde at room temperature, and permeabilized with 0.5% Triton X-100 for 10–15 minutes. The Click-iT reaction mixture (reagents from the EDU assay kit, Meilunbio, Dalian, China) was prepared. Fixed and permeabilized cells were incubated with the reaction mixture at room temperature in the dark for 30 minutes. Hoechst 33342 stain (1 μg/mL) was added to label nuclei for 5–10 minutes. Images were acquired using a fluorescence microscope, and the percentage of EDU-positive cells relative to the total number of cells was calculated.

Wound Healing Assay

Cells were seeded into 6-well plates at a density of approximately 5×10⁵ cells per well (the density could be adjusted based on cell type to ensure 90–100% confluence after overnight incubation). A straight scratch was made in the confluent cell monolayer using a 200 μL pipette tip. The medium was then replaced with serum-free medium, and cells were incubated at 37°C for 24 hours. Images of the scratched area were captured at 0 and 24 hours post-scratch using an inverted microscope. The migratory ability of transfected cells was evaluated by quantitatively analyzing the distance of cell migration from the scratch edge to the center.

Transwell Assay

Cell invasion assays were performed using Transwell chambers (Corning, USA). The upper chamber was coated with a thin layer of Matrigel. Subsequently, 100 μL of serum-free medium suspension containing 5 × 10⁴ cells was added to the upper chamber, and 500 μL of complete medium containing 10% FBS was added to the lower chamber. After incubation for 24 h, cells that had invaded to the lower surface of the membrane were fixed with 4% paraformaldehyde and stained with crystal violet. Invading or migrating cells were counted under a microscope.

RNA Extraction and qRT-PCR

Total RNA was extracted from frozen HCC tissues and cell lines using the TaKaRa MiniBEST Universal RNA Extraction Kit (Dalian, China). Reverse transcription was performed to synthesize cDNA using the PrimeScript™ RT Master Mix (Perfect Real Time) kit (Dalian, China). Quantitative real-time PCR was carried out using the SYBR^® Premix Ex Taq™ II Kit (Dalian, China) according to the manufacturer’s instructions, with the synthesized cDNA as the template. The 2-ΔΔCT method was used for quantification. Primer sequences were as follows: h-ACTB: Forward 5′-AAACGTGCTGCTGACCGAG-3′, Reverse 5′-TAGCACAGCCTGGATAGCAAC-3′; SEMA4F: Forward 5′-GGTCCAAGACATAGAGTCAGCAG-3′, Reverse 5′-TAGCCACGGGAACTTCAAACA-3′.

Western Blot

Total protein was extracted from frozen HCC tissues and cells using RIPA lysis buffer containing protease inhibitors. Protein concentration was determined using a BCA protein assay kit (NCM, Suzhou, China). Equal amounts of protein were separated by 12% or 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto PVDF membranes.⁹ The membranes were blocked with 5% skimmed milk powder dissolved in TBST buffer. After blocking, the membranes were washed 3–5 times (5 minutes per wash) and incubated with specific primary antibodies, including anti-PI3K, anti-p-PI3K, anti-AKT, anti-p-AKT and anti-β-actin antibodies. After incubation with horseradish peroxidase (HRP)-conjugated secondary antibodies, proteins were detected using enhanced chemiluminescence reagent (Thermo Fisher, USA).

Rescue Experiments

To investigate the involvement of the PI3K/Akt pathway in SEMA4F-mediated effects, rescue experiments were performed using the PI3K inhibitor LY294002 and the Akt activator SC79. LY294002 (item No. S1105, Selleckchem) was dissolved in DMSO and applied to cells at a final concentration of 10 μg/mL for 24 hours. SC79 (item No. MC8026, Meilunbio) was dissolved in DMSO and used at a final concentration of 5 μg/mL for 24 hours. Control cells received an equivalent volume of DMSO (solvent control) under otherwise identical conditions.

Statistical Analysis

Statistical analysis was performed using SPSS 20.0 software. Data were expressed as the mean ± standard deviation (SD) of at least three independent experiments. Student’s t-test was used to compare differences between two groups when variances were homogeneous; otherwise, the Mann–Whitney U-test was applied. Survival curves were plotted using the Kaplan-Meier method and compared using the Log rank test. A P value < 0.05 was considered statistically significant. All cell biology experiments and molecular biology experiments were independently repeated three times.

Results

Database Analysis Reveals That Elevated SEMA4F Expression in HCC Correlates with Poor Disease Prognosis

A pan-cancer analysis conducted using the GEPIA2 database revealed that the expression level of Semaphorin 4F was significantly upregulated in HCC tissues compared to normal liver tissues (P<0.05) (Figure 1A). This finding was subsequently confirmed using the TCGA-LIHC dataset, which showed that SEMA4F expression was significantly higher in tumor tissues than in adjacent non-tumor tissues, with a statistically significant difference (Figure 1B). Survival analysis indicated that HCC patients with high SEMA4F expression had a shorter overall survival (OS), indicating a poor prognosis (Figure 1C). Collectively, these findings suggest that SEMA4F may function as an oncogene in the initiation and progression of HCC, warranting further in-depth mechanistic investigation.

Figure 1 SEMA4F gene is upregulated in HCC tissues. (A) Analysis of SEMA4F gene expression levels in different tumors using the TIMER2.0 database; (B) Analysis of SEMA4F mRNA expression in HCC tissues based on the TCGA database; (C) Evaluation of the clinical significance of SEMA4F gene expression level for overall survival of HCC patients in the TCGA cohort.

Cancer Cell Line Screening and Establishment of SEMA4F-Overexpressing and SEMA4F-Silenced Cell Lines

To explore the biological function of SEMA4F in HCC, this study first assessed its relative expression levels in different HCC cell lines (HEPG2, HUH-7, PLC, and HEP3B) using RT-PCR. The results showed that SEMA4F expression was lowest in HUH-7 cells and highest in PLC cells (Figure 2A). Based on this expression profile, these two cell lines were selected to establish functional study models. In the loss-of-function experiment, a PLC/SEMA4F-siRNA cell model was successfully established by silencing SEMA4F expression in PLC cells using small interfering RNA (siRNA) (Figure 2B). In the gain-of-function experiment, a stable SEMA4F-overexpressing HUH-7 cell line (HUH-7/SEMA4F-OE) was successfully constructed via lentiviral transfection using a T8263 vector; RT-PCR verification confirmed a significant upregulation of SEMA4F expression in this cell line (Figure 2C).

Figure 2 (A) Relative expression levels of SEMA4F mRNA in HCC cell lines (HEPG2, HUH-7, PLC, and HEP3B); (B and C) Establishment of knockdown/overexpression models. qRT-PCR was used to detect the transfection efficiency of SEMA4F knockdown in PLC cells and the overexpression efficiency of SEMA4F in HUH-7 cells. **P < 0.01,****P < 0.0001.

SEMA4F Promotes HCC Cell Proliferation and Colony Formation

To further elucidate the biological role of SEMA4F in HCC progression, this study examined its impact on the malignant phenotypes of HCC cells. Colony formation assay results indicated that SEMA4F overexpression significantly enhanced the clonogenic ability of HUH-7 cells, while silencing SEMA4F expression in PLC cells significantly decreased the number of formed colonies (Figure 3A). EdU incorporation assay results showed that compared to the negative control (NC) group, the DNA synthesis capacity was significantly enhanced in the SEMA4F-OE group of HUH-7 cells; conversely, the DNA synthesis capacity was reduced in the SEMA4F-siRNA group of PLC cells, suggesting that SEMA4F promotes the proliferation of HCC cells (Figure 3B). Therefore, SEMA4F enhances the long-term proliferative potential and survival capability of HCC cells in vitro.

Figure 3 continued.

Figure 3 SEMA4F promotes proliferation, migration and invasion of HCC cells in vitro. (A) Colony formation assay was used to evaluate the changes in cell proliferation capacity of SEMA4F-knockdown PLC cells and SEMA4F-overexpressing HUH-7 cells; (B) EdU assay was performed to detect the changes in DNA synthesis capacity of SEMA4F-knockdown PLC cells and SEMA4F-overexpressing HUH-7 cells; (C) Transwell invasion assay showed the invasive capacity of PLC/SEMA4F-siRNA, HUH-7/SEMA4F-OE and their control cells at 24 h; (D) Wound healing assay showed the migratory capacity of PLC/SEMA4F-siRNA, HUH-7/SEMA4F-OE and their control cells at 0 h and 24 h. Data were presented as mean ± standard deviation (SD) of three independent experiments. **P < 0.01.

SEMA4F Enhances HCC Cell Invasion and Migration

In addition to proliferative capacity, cell migration and invasion abilities are key factors determining tumor metastatic potential. To clarify the role of SEMA4F in these processes, this study conducted wound healing assays and Transwell invasion assays. Transwell invasion assay results demonstrated that SEMA4F overexpression significantly enhanced the invasive ability of HUH-7 cells; conversely, SEMA4F silencing in PLC cells (SEMA4F-siRNA) markedly impaired their ability to penetrate the Matrigel-coated membrane (Figure 3C). Wound healing assay results showed that compared to the NC group, the wound healing rate was significantly accelerated in HUH-7 cells with SEMA4F overexpression (SEMA4F-OE), while the migration rate was slowed down in PLC cells of the SEMA4F-siRNA group (Figure 3D). These results suggest that SEMA4F can promote the migration and invasion of HCC cells.

Transcriptome Sequencing and Bioinformatics Analysis

Transcriptome sequencing was performed to investigate the potential molecular mechanisms regulated by SEMA4F in HCC. The results revealed significant differences in the gene expression profiles between the HUH-7/SEMA4F-overexpressing cells and NC cells, identifying a total of 735 differentially expressed genes (DEGs), including 631 upregulated genes and 104 downregulated genes (Figure 4A–C). Gene Ontology (GO) enrichment analysis of the DEGs indicated significant enrichment in various biological processes (BP), cellular components (CC), and molecular functions (MF) (Figure 4D and E). The DEGs were highly enriched in cell membrane and plasma membrane components, suggesting potential involvement in signal reception and transduction processes. The most significantly enriched molecular function category was protein binding, indicating extensive protein-protein interactions in HCC progression. In terms of biological processes, DEGs were mainly enriched in signal transduction pathways, implying that aberrant regulation (activation or inhibition) may occur in these related signaling pathways. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis showed that the DEGs were significantly enriched in functional pathways related to cytoskeleton remodeling, cell motility, activation of classical signaling pathways, and metabolic reprogramming (Figure 4F). Furthermore, among the top 20 enriched KEGG pathways, the PI3K-Akt signaling pathway had the highest enrichment score (Figure 4G). These findings provide important clues for deciphering the molecular regulatory mechanisms in HCC and have identified potential therapeutic targets worthy of further research.

Figure 4 continued.

Figure 4 Transcriptome sequencing and bioinformatics analysis of HUH-7/SEMA4F-OE and NC cells. (A) Volcano plot of DEGs; (B) Upregulated and downregulated DEGs; (C) Heatmap of DEGs; (D) GO analysis of DEGs; (E) Top 20 enriched GO terms; (F) KEGG analysis of DEGs; (G) Top 20 enriched KEGG signaling pathways.

SEMA4F Positively Regulates the Activation of the PI3K-Akt Signaling Pathway in HCC Cells

To investigate whether SEMA4F regulates the PI3K-Akt signaling pathway, this study used Western blotting to detect the expression levels of key proteins in this pathway in HCC cells. The results showed that, compared to the NC group, SEMA4F silencing in PLC cells significantly reduced the expression levels of phosphorylated PI3K (p-PI3K) and phosphorylated AKT (p-AKT). On the contrary, the expression levels of p-PI3K and p-AKT were significantly increased in HUH-7 cells with SEMA4F overexpression (Figure 5A). These results suggest that SEMA4F positively regulates the activation of thePI3K-Akt signaling pathway in HCC cells, which is consistent with the prediction from the KEGG enrichment analysis that “SEMA4F may be involved in regulating this core oncogenic pathway.”

Figure 5 SEMA4F can positively regulate the activation of PI3K-AKT signaling pathway in HCC cells. (A) Western blot was used to detect the effect of SEMA4F knockdown/overexpression on PI3K-AKT pathway-related proteins; (B) Rescue experiments were conducted by adding SC79 and LY294002 after SEMA4F knockdown/overexpression, and Western blot was used to detect the expression changes of PI3K-AKT pathway-related proteins. Data were presented as mean ± SD of three independent experiments. **P < 0.01. Abbreviation: ns, not significant.

SEMA4F Regulates the Malignant Phenotype of HCC Cells by Modulating the PI3K-Akt Signaling Pathway

To further verify whether SEMA4F regulates the malignant phenotypes of HCC cells through the PI3K-Akt pathway, this study conducted rescue experiments using the AKT activator SC79 and the PI3K inhibitor LY294002. Western blot results showed that treatment of SEMA4F-siRNA group cells with SC79 restored the expression of p-AKT in PLC cells; treatment of SEMA4F-OE group cells with LY294002 inhibited the protein expression of p-PI3K and p-AKT (Figure 5B). Colony formation assay results indicated that in the SEMA4F-siRNA group, SC79 could partially restore the clonogenic ability of PLC cells; the PI3K inhibitor LY294002 suppressed the the clonogenic ability of HUH-7 cells in the SEMA4F-OE group (Figure 6A). EdU incorporation assay results showed that SC79 could restore the proliferation of PLC cells (Figure 6B); conversely, the LY294002 suppressed the proliferation of HUH-7 cells in the SEMA4F-OE group (Figure 6C). Transwell invasion assay results demonstrated in the SEMA4F-siRNA group, SC79 could restore the invasive capacities of PLC cells; the PI3K inhibitor LY294002 suppressed the invasion of HUH-7 cells in the SEMA4F-OE group (Figure 7A). Besides, wound healing assay results demonstrated that SC79 could restore the migratory capacities of PLC cells in the SEMA4F-siRNA group; and the LY294002 suppressed the migration of HUH-7 cells in the SEMA4F-OE group (Figure 7B). Collectively, these rescue experiment results indicate that SEMA4F promotes HCC cell proliferation, migration, and invasion at least partially through PI3K-Akt pathway activation; however, other mechanisms likely contribute.

Figure 6 continued.

Figure 6 Changes in proliferation capacity of HCC cells after treatment with SC79/LY294002. (A) Colony formation assay showed that SC79 could rescue the colony formation capacity of PLC/SEMA4F-siRNA cells, and LY294002 could inhibit the colony formation capacity of HUH-7/SEMA4F-OE cells. (B) EdU assay showed that SC79 could rescue the DNA synthesis capacity of PLC/SEMA4F-siRNA cells. (C) LY294002 could inhibit the DNA synthesis capacity of HUH-7/SEMA4F-OE cells. Data were presented as mean ± SD of three independent experiments. **P < 0.01.

Figure 7 continued.

Figure 7 Changes in invasion and migration capacity of HCC cells after treatment with SC79/LY294002. (A) Transwell invasion assay showed that SC79 could rescue the invasive capacity of PLC/SEMA4F-siRNA cells, and LY294002 could inhibit the invasive capacity of HUH-7/SEMA4F-OE cells. (B) Wound healing assay showed that SC79 could rescue the migratory capacity of PLC/SEMA4F-siRNA cells, LY294002 could inhibit the migratory capacity of HUH-7/SEMA4F-OE cells. Data were presented as mean ± SD of three independent experiments. **P < 0.01.

Discussion

Liver cancer is one of the most common malignant tumors of the digestive system worldwide and also ranks among the leading causes of cancer-related deaths in China.¹ Hepatocellular carcinoma, the most prevalent subtype of primary liver cancer, exhibits a rising incidence and limited treatment options, particularly for patients diagnosed at advanced stages. Owing to the high recurrence and metastasis rates of HCC, the 5-year survival rate of affected patients remains below 20%. To achieve early detection and treatment, thereby improving survival rates, exploring novel therapeutic targets and biomarkers has become an urgent priority in current liver cancer research.

Semaphorins constitute a diverse family of secreted and membrane-associated signaling proteins, categorized into three subtypes: secreted, transmembrane, and membrane-anchored. Accumulating evidence indicates that semaphorins play pivotal roles in tumor biology by interacting with components of the tumor microenvironment (TME) to modulate tumor progression.^10,11 SEMAs exert their biological effects through binding to specific receptors/coreceptors, including plexins, neuropilins, and integrins, thereby regulating downstream effector pathways such asPI3K-Akt and MAPK/ERK.¹² Some semaphorins, including SEMA4D, SEMA6A, and SEMA7A, are involved in promoting tumor progression.^11,13 In contrast, others such as SEMA3B and SEMA3F have been identified as tumor suppressors.^14,15 For instance, studies have found that serum SEMA3B expression is downregulated in tumor tissues of HCC patients, and decreased expression is associated with poor prognosis.¹⁴ Among the semaphorin family, class IV semaphorins represent the largest transmembrane subclass, encompassing SEMA4A-G. Reports indicate that SEMA4A is expressed in various immune cells and can influence the malignant progression of liver cancer by promoting epithelial-mesenchymal transition (EMT);¹⁶ SEMA4B not only mediates immune cell responses but also inhibits the progression of non-small cell lung cancer;¹⁷ high SEMA4C expression is associated with poor prognosis in breast cancer;¹⁸ and SEMA4D participates in multiple biological processes including neural development and immune regulation, with implications for malignant tumor prognosis.¹⁹

Semaphorin 4F is a transmembrane semaphorin localized to cell membrane fragments and the plasma membrane. It exerts biological functions via binding of its extracellular domain to receptors such as plexins. These interactions can activate downstream signaling pathways, impacting diverse cellular processes including proliferation, migration, differentiation, apoptosis, and immune regulation. The TME is a critical determinant of tumor growth and metastasis, and SEMA4F plays key roles in multiple biological processes, particularly in immune regulation, TME remodeling, and crosstalk with other signaling pathways. For example, SEMA4F may transduce signals through interaction with its receptors (eg., plexin family members) to modulate the functions of immune cells such as T cells, B cells, and macrophages.²⁰ SEMA4F has also been shown to regulate the function of tumor-associated macrophages (TAMs), which exhibit dual roles in the TME by either suppressing or promoting tumor progression. Recent studies have revealed a close association between SEMA4F and cancer progression. The research group led by Benjamin Deneen at Baylor College of Medicine demonstrated that SEMA4F is highly enriched in invasive tumor cells of primary glioblastoma, and that remote neuronal activity promotes tumor progression and extensive infiltration via SEMA4F.⁸ In gastric cancer, SEMA4F expression is significantly upregulated in tumor tissues and cell lines, with high expression correlating with poor patient prognosis.⁷ Furthermore, SEMA4F not only affects tumor cell proliferation and migration but also remodels the TME through interactions with neurons.²¹ For instance, in glioblastoma multiforme (GBM), SEMA4F enhances tumor invasiveness and malignancy by facilitating bidirectional signaling between neurons and tumor cells.^8,22 This interaction may promote tumor cell invasion by remodeling synapses in the peritumoral region. Axonogenesis, a biological process known to play a role in breast cancer metastatic progression, has been reported to be eliminated and distant metastasis attenuated upon silencing of the Platr18/Sema4F axis in breast cancer.²³ In prostate cancer, SEMA4F contributes to the formation of perineural invasion (PNI) by increasing axon numbers, with its expression levels positively correlating with nerve density and perineural invasion degree.^24,25 SEMA4F also interacts with multiple signaling pathways to influence tumor biological behavior. Research indicates that SEMA4F can crosstalk with the transforming growth factor-β (TGF-β) signaling pathway to regulate EMT, thereby promoting tumor cell migration and metastasis.²⁶ Additionally, SEMA4F is involved in regulating oxidative phosphorylation and other tumor-related signaling pathways crucial for tumor cell metabolism and survival.

As a transmembrane protein, SEMA4F plays important roles in cellular signal transduction and immune regulation. In recent years, increasing evidence suggests that SEMA4F is involved in promoting various malignant phenotypes such as proliferation, migration, invasion, and angiogenesis in multiple tumor types. Our previous bioinformatics analysis identified SEMA4F as an IRG associated with patient survival in HCC.²⁷ However, the specific molecular mechanisms underlying its role in HCC remain to be fully elucidated.

Validation results based on the GEPIA2 pan-cancer database and TCGA database revealed that SEMA4F expression levels are significantly higher in HCC tissues compared to normal liver tissues. Further functional experiments showed that overexpression of SEMA4F in the human HCC cell line HUH-7 enhances cell proliferation, colony formation, invasion, and migration capabilities. Conversely, knockdown of SEMA4F via siRNA in PLC cells results in decreased proliferation, colony formation, invasion, and migration. These findings suggest that SEMA4F functions as an oncogene to promote HCC progression.

SEMA4F influences tumor cell malignant phenotypes through multiple mechanisms. In endometrial cancer, high SEMA4F expression correlates with advanced clinical stage, higher pathological grade, and poor prognosis, indicating its pro-tumorigenic role.²⁸ Tumor metastasis is a hallmark of tumor growth and dissemination, and SEMA4F plays a crucial role in this process. First, SEMA4F can alter cell motility by regulating cytoskeleton reorganization. Studies have shown that SEMA4F expression is closely associated with tumor cell motility, potentially through interaction with cell membrane receptors to activate downstream signaling pathways, thereby promoting cell migration and invasion. For example, in GBM, SEMA4F modulates tumor cell migration behavior by influencing immune cell infiltration in the TME.^20,29 In pediatric medulloblastoma, SEMA4F expression correlates with the expression of multiple genes involved in tumor cell migration and proliferation.³⁰ In HCC, Yue’s team demonstrated that the expression level of SEMA4F is associated with tumor histological grade and vascular invasion, and HCC patients with high SEMA4F expression have a poor prognosis.³¹ By modulating neural signaling within the TME, SEMA4F may influence interactions between tumor cells and stromal cells, potentially affecting tumor cell migration and invasive capacity.

To further investigate the specific mechanisms by which SEMA4F regulates HCC, transcriptome sequencing was performed to detect differentially expressed genes (DEGs) between SEMA4F-overexpressing (SEMA4F-OE) and negative control (NC) HUH-7 cells, followed by functional enrichment analysis of these DEGs. Sequencing results identified a total of 735 DEGs, including 631 upregulated and 104 downregulated genes. Upregulated genes were primarily involved in cell-cell adhesion and signal transduction, such as collagen-related genes associated with extracellular matrix (ECM) remodeling, and FSCN1 and MMP11 linked to metabolic reprogramming and migration. Downregulated genes were involved in inflammation suppression (eg., DUSP1 and CXCL family members); for instance, CXCL2, CXCL3, and CXCL8 participate in the IL-8/CXCR1/2 signaling pathway to regulate neutrophil chemotaxis and inflammatory responses, and their downregulation may inhibit the inflammatory microenvironment, potentially reflecting enhanced tumor immune evasion or invasiveness. Gene Ontology (GO) analysis revealed that DEGs were enriched in multiple biological process (BP), cellular component (CC), and molecular function (MF) categories. BPs were mainly enriched in signal transduction, suggesting potential abnormal activation or inhibition of specific signaling pathways; CCs were primarily enriched in membrane and plasma membrane, indicating involvement in signal reception and transduction; MFs were mainly enriched in protein binding and metal ion binding, suggesting participation in extensive protein-protein interactions in HCC cells. KEGG pathway enrichment analysis showed that DEGs were significantly enriched in functional terms related to cytoskeleton remodeling, cell motility, activation of classic signaling pathways, and metabolic reprogramming. Notably, several pathways closely associated with HCC pathogenesis and immune microenvironment regulation were identified, including the PI3K-Akt signaling pathway (hsa04151), MAPK signaling pathway (hsa04010), cytokine-cytokine receptor interaction pathway (hsa04060), calcium signaling pathway (hsa04020), and Ras signaling pathway (hsa04014). Based on the KEGG analysis, SEMA4F may activate downstream signaling cascades such as PI3K-Akt, MAPK/Ras, and calcium signaling pathways through receptor binding, thereby driving malignant phenotypes in HCC cells. In our study, the PI3K-Akt pathway was the most significantly enriched signaling pathway. As a core pathway regulating cell proliferation, apoptosis, and metabolism, it is frequently aberrantly activated in HCC and closely associated with tumor malignant phenotypes³².

Further studies showed that knockdown of SEMA4F via siRNA in PLC cells decreased p-PI3K and p-AKT levels, whereas overexpression of SEMA4F in Huh-7 cells increased p-PI3K and p-AKT levels. A rescue experiment targeting thePI3K-Akt signaling pathway was subsequently performed. Results demonstrated that the PI3K inhibitor LY294002 reversed the pro-proliferative, pro-migratory, and pro-invasive effects of SEMA4F. Conversely, the AKT activator SC79 promoted proliferation, migration, and invasion of PLC cells, reversing the inhibitory effects of SEMA4F siRNA. Collectively, these findings indicate that SEMA4F regulates malignant phenotypes and prognosis of HCC at least partially through modulation of thePI3K-Akt signaling pathway.

The PI3K-Akt pathway serves as a core regulatory hub interacting with other pathways, including ECM-receptor interaction, protein digestion and absorption, PPAR signaling pathway, and axon guidance.^33,34 In HCC metastasis,PI3K-Akt signaling stimulates EMT, increases matrix metalloproteinase (MMP) expression, and promotes angiogenesis.³⁵ M2-type macrophages participate in hepatic fibrosis and immune tolerance processes during HCC development and progression, and their function is regulated by the PI3K-Akt-mTOR pathway.³⁶ Pathways such as focal adhesion, regulation of actin cytoskeleton, and cytoskeleton in muscle cells are associated with enhanced cytoskeletal dynamics and cell motility, influencing cell migration, invasion, and morphological changes. SEMA4F may promote metastatic potential of HCC cells by regulating actin dynamics and focal adhesion formation, consistent with the role of semaphorin family proteins in modulating the cytoskeleton in various tumors. Genes including COL1A1, COL1A2, and COL6A2 are involved in collagen synthesis, while LTBP4 and TNS1 participate in cell-matrix adhesion; these genes also regulate the TGF-β signaling pathway, potentially reflecting ECM remodeling and EMT processes that promote tumor invasion. Additionally, downregulated tumor suppressor genes (eg., CDKN2C) and upregulated pro-metastatic genes (eg., MMP11, FSCN1) may drive malignant phenotypes.

Hormones, cytokines, and growth factors can activate the intracellularPI3K-Akt signaling pathway and its related downstream targets. PTEN deletion inducesPI3K-Akt pathway activation, promotes MMP-9 expression, and enhances HCC metastasis.³⁷ Bone morphogenetic protein 2 (BMP2) inhibits HCC invasion by suppressing thePI3K-Akt signaling pathway and reducing MMP-2 expression.³⁸ In HCC tissues, PI3K is significantly overexpressed, and PIK3CA upregulation positively correlates with HCC cell proliferation and negatively correlates with apoptosis. ThePI3K-Akt pathway inhibits apoptosis by suppressing pro-apoptotic proteins and activating mTOR.³⁵ It also promotes the expression of EMT-related factors through regulation of GSK-3β, NF-κB, and other molecules. The ECM serves as a potent activating signal for thePI3K-Akt pathway, and increased ECM stiffness is a key characteristic of HCC.³⁹ The activatedPI3K-Akt pathway feedback-regulates ECM remodeling; for example, Akt upregulates the synthesis of ECM components such as collagen by activating mTOR and downstream effectors, whilePI3K-Akt signaling can modulate MMP expression to affect ECM degradation and remodeling. Inhibition of thePI3K-Akt pathway reduces tumor BH4 and NO levels, thereby inhibiting angiogenesis; furthermore, reducing ECM stiffness may increase the sensitivity of HCC to sorafenib.⁴⁰

In recent years, metabolic reprogramming has emerged as a hallmark of cancer. Pathways including PPAR signaling, steroid hormone biosynthesis, and purine metabolism are involved in metabolic reprogramming, regulating lipid metabolism, drug metabolism, and purine metabolism in HCC. These findings suggest that SEMA4F may promote tumor adaptation to the microenvironment through metabolic remodeling. ThePI3K-Akt pathway is a core regulator of cellular metabolism, promoting glucose uptake, glycolysis, and protein synthesis.⁴¹ Downregulation of Ferredoxin 1 facilitates metabolic reprogramming and induces ROS-mediated mitophagy andPI3K-Akt pathway activation.⁴² HIF-1α and RAS/PI3K/AKT signaling may induce chemoresistance by enhancing aerobic glycolysis in cancer cells.⁴³ As a master regulator of cellular metabolism, thePI3K-Akt pathway governs the reprogramming of arginine/proline metabolism.⁴⁴ On the one hand, it can directly regulate key enzymes involved in arginine and proline metabolism in HCC; on the other hand, metabolites of arginine/proline metabolism feedback-activate thePI3K-Akt pathway. This positive feedback loop forms a self-reinforcing oncogenic signal amplification circuit that maintains redox homeostasis, shapes an immunosuppressive microenvironment, and promotes fibrosis and cirrhosis. Additionally, multidrug resistance in HCC is associated with alterations in glutathione metabolism, arginine and proline metabolism, and other metabolic processes, and modulating amino acid metabolism can influence tumor immune responses.⁴⁵ Due to the role of metabolic reprogramming, interactions between thePI3K-Akt/mTOR pathway and metabolism can reshape the immunosuppressive networks prevalent in various cancers.

Axon guidance molecules and their receptors are not exclusive to the nervous system but are also widely expressed in HCC cells and the TME,⁴⁶ directly participating in oncogenic signal transduction. Perineural invasion represents a unique invasive pattern of HCC. Extensive crosstalk exists between axon guidance receptors and classic growth factor receptors, which synergistically amplify PI3K-Akt signaling. For example, Neuropilin-1 acts not only as a coreceptor for semaphorins but also for vascular endothelial growth factor (VEGF), enhancing VEGFR2 signaling and potently promotingPI3K-Akt activation to drive angiogenesis.⁴⁷ PI3K-Akt activation is essential for cell pseudopodia formation; axon guidance molecules can act as “chemoattractive signals” to direct cancer cell growth and migration toward nerve fibers, while the activatedPI3K-Akt pathway provides energy and anti-apoptotic support for this long-distance invasion. Furthermore, axon guidance molecules can regulate immune cell chemotaxis and function. For instance, Sema4D, via its receptor Plexin-B1, can directly recruit and activate PI3K, promoting Akt phosphorylation and driving cell migration and invasion.⁴⁸

Therefore, thePI3K-Akt pathway may serve as a core hub interacting with multiple pathways including ECM-receptor interaction, protein digestion and absorption, PPAR signaling pathway, axon guidance, and metabolic reprogramming. In HCC, SEMA4F likely exhibits pleiotropic effects; overexpression promotes proliferation and invasion in vitro and activates PI3K-Akt pathway. Whether SEMA4F promotes immune suppression remains to be determined.

In conclusion, the findings of this study indicate that SEMA4F acts as an oncogenic driver in HCC, potentially regulating malignant progression through thePI3K-Akt pathway and correlating closely with clinical prognosis. These results provide important insights into the role and mechanism of SEMA4F in HCC, which may eventually serve as a prognostic biomarker and therapeutic target of HCC pending in vivo validation and clinical investigation. And formal biomarker validation including ROC analysis, multivariate prognostic analysis, and prospective validation in independent patient cohorts would be required to establish clinical utility.

Limitations of the Study

Due to the lack of an independent clinical cohort, the correlation between SEMA4F expression and clinicopathological features such as tumor stage, grade, and metastasis could not be conclusively determined in this study. Future investigations using large-scale clinical samples are warranted to validate these potential associations. And in the future research, we plan to verify the effects of SEMA4F on tumor growth and metastasis, as well as the role of the PI3K/Akt pathway in nude mice for in vivo study.